cropseq puro v2 (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
cropseq puro v2
Cropseq Puro V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cropseq+puro+v2/CROPseq-puro-v2+(Plasmid+%23127458)/bio_rxiv__64898__2026__02__10__705126-301-9-10
Average 93 stars, based on 20 article reviews
Cropseq Puro V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cropseq+puro+v2/CROPseq-puro-v2+(Plasmid+%23127458)/bio_rxiv__64898__2026__02__10__705126-301-9-10
Average 93 stars, based on 20 article reviews
cropseq puro v2 - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Software:Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or CROPseq-puro-v2 (Addgene #127458), using NEBuilder HiFi 442 DNA Assembly (NEB #E5520S) and BsmBI (NEB #0739S) restriction sites. .. Either the 443 CRISPick [42] or sgRNA Scorer [43] web-based software was used to design sgRNA 444 CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting 445 controls. sgRNA sequences were individually synthesized (IDT) and independently 446 cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene 447 #86708) or Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: .. 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway Article Snippet: .. Either the CRISPick [ ] or sgRNA Scorer [ ] web-based software was used to design sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting controls. sgRNA sequences were individually synthesized (IDT) and independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene #86708) or CRISPR:Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or CROPseq-puro-v2 (Addgene #127458), using NEBuilder HiFi 442 DNA Assembly (NEB #E5520S) and BsmBI (NEB #0739S) restriction sites. .. Either the 443 CRISPick [42] or sgRNA Scorer [43] web-based software was used to design sgRNA 444 CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting 445 controls. sgRNA sequences were individually synthesized (IDT) and independently 446 cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene 447 #86708) or Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: .. 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway Article Snippet: .. Either the CRISPick [ ] or sgRNA Scorer [ ] web-based software was used to design sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting controls. sgRNA sequences were individually synthesized (IDT) and independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene #86708) or Knock-Out:Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or CROPseq-puro-v2 (Addgene #127458), using NEBuilder HiFi 442 DNA Assembly (NEB #E5520S) and BsmBI (NEB #0739S) restriction sites. .. Either the 443 CRISPick [42] or sgRNA Scorer [43] web-based software was used to design sgRNA 444 CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting 445 controls. sgRNA sequences were individually synthesized (IDT) and independently 446 cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene 447 #86708) or Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: .. 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway Article Snippet: .. Either the CRISPick [ ] or sgRNA Scorer [ ] web-based software was used to design sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting controls. sgRNA sequences were individually synthesized (IDT) and independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene #86708) or Synthesized:Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or CROPseq-puro-v2 (Addgene #127458), using NEBuilder HiFi 442 DNA Assembly (NEB #E5520S) and BsmBI (NEB #0739S) restriction sites. .. Either the 443 CRISPick [42] or sgRNA Scorer [43] web-based software was used to design sgRNA 444 CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting 445 controls. sgRNA sequences were individually synthesized (IDT) and independently 446 cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene 447 #86708) or Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: .. 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway Article Snippet: .. Either the CRISPick [ ] or sgRNA Scorer [ ] web-based software was used to design sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting controls. sgRNA sequences were individually synthesized (IDT) and independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene #86708) or Clone Assay:Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or CROPseq-puro-v2 (Addgene #127458), using NEBuilder HiFi 442 DNA Assembly (NEB #E5520S) and BsmBI (NEB #0739S) restriction sites. .. Either the 443 CRISPick [42] or sgRNA Scorer [43] web-based software was used to design sgRNA 444 CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting 445 controls. sgRNA sequences were individually synthesized (IDT) and independently 446 cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene 447 #86708) or Article Title: Mapping multimodal phenotypes to perturbations in cells and tissue with CRISPRmap. Article Snippet: .. Amplified oligo pools were cloned into a modified Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: .. 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway Article Snippet: .. Either the CRISPick [ ] or sgRNA Scorer [ ] web-based software was used to design sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting controls. sgRNA sequences were individually synthesized (IDT) and independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene #86708) or Article Title: High-content image-based pooled screens reveal regulators of synaptogenesis. Article Snippet: To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into CROPseq-puro-v2 (Addgene #127458) with Golden Gate assembly using the Esp3I restriction enzyme, and lentivirus was produced and spinfected as described above. .. To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into Article Title: High-content image-based pooled screens reveal regulators of synaptogenesis Article Snippet: .. The guide was cloned into Expressing:Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or CROPseq-puro-v2 (Addgene #127458), using NEBuilder HiFi 442 DNA Assembly (NEB #E5520S) and BsmBI (NEB #0739S) restriction sites. .. Either the 443 CRISPick [42] or sgRNA Scorer [43] web-based software was used to design sgRNA 444 CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting 445 controls. sgRNA sequences were individually synthesized (IDT) and independently 446 cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene 447 #86708) or Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: .. 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway Article Snippet: .. Either the CRISPick [ ] or sgRNA Scorer [ ] web-based software was used to design sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting controls. sgRNA sequences were individually synthesized (IDT) and independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene #86708) or other:Article Title: Mapping multimodal phenotypes to perturbations in cells and tissue with CRISPRmap Article Snippet: HEK293FT cells (Thermo Fisher Scientific, R70007 ) were cultured in DMEM (Gibco, 11965092) supplemented with heat-inactivated 10% FBS (American Type Culture Collection (ATCC), 30–2020) and 100 U ml −1 penicillin–streptomycin (Thermo Fisher Scientific, 15140163). Amplification:Article Title: Mapping multimodal phenotypes to perturbations in cells and tissue with CRISPRmap. Article Snippet: .. Amplified oligo pools were cloned into a modified Article Title: X-CODE: a dual RNA barcoding system for multi-platform clonal tracking and spatial phenotyping Article Snippet: .. For add-ons integration, the scaffold-gRNA segment was amplified from Modification:Article Title: Mapping multimodal phenotypes to perturbations in cells and tissue with CRISPRmap. Article Snippet: .. Amplified oligo pools were cloned into a modified Sequencing:Article Title: Mapping multimodal phenotypes to perturbations in cells and tissue with CRISPRmap. Article Snippet: .. Amplified oligo pools were cloned into a modified Cloning:Article Title: Optical pooled screening for the discovery of regulators of the alternative lengthening of telomeres pathway. Article Snippet: .. 436 4.3.sgRNA design and cloning 437 Either the CRISPick [42] or sgRNA Scorer [43] web-based software was used to design 438 sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non439 targeting controls. sgRNA sequences were individually synthesized (IDT) and 440 independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide441 Puro (Addgene #86708) or Activity Assay:Article Title: High-content image-based pooled screens reveal regulators of synaptogenesis. Article Snippet: To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into CROPseq-puro-v2 (Addgene #127458) with Golden Gate assembly using the Esp3I restriction enzyme, and lentivirus was produced and spinfected as described above. .. To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into Transduction:Article Title: High-content image-based pooled screens reveal regulators of synaptogenesis. Article Snippet: To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into CROPseq-puro-v2 (Addgene #127458) with Golden Gate assembly using the Esp3I restriction enzyme, and lentivirus was produced and spinfected as described above. .. To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into Produced:Article Title: High-content image-based pooled screens reveal regulators of synaptogenesis. Article Snippet: To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into CROPseq-puro-v2 (Addgene #127458) with Golden Gate assembly using the Esp3I restriction enzyme, and lentivirus was produced and spinfected as described above. .. To verify Cas9 activity, clones were transduced with a guide targeting TFRC (spacer, 5′–GCTATACGCCACATAACCCCC–3′).30 The guide was cloned into Article Title: High-content image-based pooled screens reveal regulators of synaptogenesis Article Snippet: .. The guide was cloned into Polymerase Chain Reaction:Article Title: X-CODE: a dual RNA barcoding system for multi-platform clonal tracking and spatial phenotyping Article Snippet: .. For add-ons integration, the scaffold-gRNA segment was amplified from Purification:Article Title: X-CODE: a dual RNA barcoding system for multi-platform clonal tracking and spatial phenotyping Article Snippet: .. For add-ons integration, the scaffold-gRNA segment was amplified from Gel Purification:Article Title: X-CODE: a dual RNA barcoding system for multi-platform clonal tracking and spatial phenotyping Article Snippet: .. For add-ons integration, the scaffold-gRNA segment was amplified from |